pgl3‐basic luciferase expression vector (Promega)
90
Structured Review
Promega
pgl3‐basic luciferase expression vector
Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
Average 90 stars, based on 1 article reviews
Pgl3‐Basic Luciferase Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgl3+basic+luciferase+expression+vector/pgl3+basic/pmc11010005-43-21-25
Average 90 stars, based on 1 article reviews
pgl3‐basic luciferase expression vector - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex"
Article Title: Stroke Causes DNA Methylation at Ncx1 Heart Promoter in the Brain Via DNMT1/MeCP2/REST Epigenetic Complex
Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease
doi: 10.1161/JAHA.123.030460
Figure Legend Snippet: A , Alignment of the human, mouse, and rat Ht sequences is shown. Conserved nucleotides are marked with asterisk. The arrow indicates the TSS. B through E , Luciferase assay in SH‐SY5Y cells transfected for 48 hour with pGL3‐Br ( B and D ) or pGL3‐Ht ( C and E ) and cotransfected with siCTL, siDNMT1, siMeCP2, or siREST ( B , C ), or with EV, DNMT1, MeCP2, or REST ( D and E ). * P ≤0.05 vs siCTL or EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). CTL indicates control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; REST, repressor element 1‐silencing transcription factor; si, small interfering; and TSS, transcription start site.
Techniques Used: Luciferase, Transfection, Plasmid Preparation, Binding Assay, Construct
Figure Legend Snippet: A , Top: JASPAR matrix representation (MA0138.1) of the consensus REST binding site on Ht gene ( Ht ‐RE1). Ht ‐RE1 sequence is represented in International Union of Pure and Applied Chemistry code. Bottom: Partial human genomic Ht sequence containing the predicted REST binding site (underlined). B , Luciferase assay in SH‐SY5Y cells under the following experimental conditions: (1) pGL3basic, (2) pGL3‐Ht+EV, (3) pGL3‐Ht+REST, (4) pGL3‐Ht‐RE1mut+EV, (5) pGL3‐Ht‐RE1mut+REST. * P ≤0.05 vs pGL3Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). C , ChIP with anti‐REST antibody followed by qPCR of the promoter region containing the RE1 site on the Ht gene in SH‐SY5Y cells transiently transfected with (1) pGL3‐Ht+EV, (2) pGL3‐Ht+REST, (3) pGL3‐Ht+RE1mut+REST. * P ≤0.05 vs pGL3‐Ht+EV by 1‐way ANOVA analysis followed by Tukey's post hoc test (n=4). ChIP indicates chromatin immunoprecipitation; CTL, control; DNMT1, DNA‐methyltransferase‐1; EV, empty vector; Ht , heart promoter, MeCP2, methyl‐CpG binding protein 2; NCX1, sodium/calcium exchanger 1; pGL3‐Br, Ncx1 brain promoter construct inserted in pGL3basic; pGL3‐Ht, Ncx1 heart promoter construct inserted in pGL3basic; qRT‐PCR, quantitative real time polymerase chain reaction; RE1, repressor element 1; and REST, repressor element 1‐silencing transcription factor.
Techniques Used: Binding Assay, Sequencing, Luciferase, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Construct, Quantitative RT-PCR, Real-time Polymerase Chain Reaction
Related Articles
Luciferase:Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3 Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Expressing:Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3 Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Plasmid Preparation:Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3 Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Construct:Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the Sequencing:Article Title: A Functional Variant of the Dimethylarginine Dimethylaminohydrolase-2 Gene Is Associated with Insulin Sensitivity Article Snippet: A 1755 bp fragment of the human DDAH2 gene spanning the promoter region and the first exon, was obtained by polymerase chain reaction (PCR) from a human genomic DNA sample and the variant carrying the rs9267551 C minor allele was generated using the QuickChange Site-Directed Mutagenesis kit (Stratagene, Las Vegas, NV). .. Both fragments were inserted in the Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the Polymerase Chain Reaction:Article Title: Tau accumulation activates STAT1 triggering memory deficits via suppressing NMDA receptor expression Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, PCR fragments ( ) from the mouse genomic DNA were inserted into the BglII and NcoI sites of the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3 Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the Article Title: STAT3 ameliorates cognitive deficits by positively regulating the expression of NMDARs in a mouse model of FTDP-17 Article Snippet: .. To generate luciferase reporter plasmids of GluN1, GluN2A or GluN2B promoter, after copied from the mouse genomic DNA, PCR fragments were subcloned into Synthesized:Article Title: Estradiol Ameliorates Acute Kidney Ischemia-Reperfusion Injury by Inhibiting the TGF-βRI-SMAD Pathway Article Snippet: .. To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the Clone Assay:Article Title: Poly(ADP-ribose) Polymerase 1 Is Indispensable for Transforming Growth Factor-β Induced Smad3 Activation in Vascular Smooth Muscle Cell Article Snippet: Specific binding was detected with ECL detection reagents (Pierce) and band intensities were quantified as described above. .. A 0.6-kb promoter fragment (spanning from +866 bp to +1523 bp) from the rat TIMP1 gene was cloned by PCR from rat genomic DNA and inserted into the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the Amplification:Article Title: Indoxyl Sulfate Down-Regulates SLCO4C1 Transporter through Up-Regulation of GATA3 Article Snippet: Human quantitative real-time PCR of GATA2 (Hs00231119_m1), GATA3 (Hs00231122_m1), SLCO4C1 (Hs00698884_m1) and GAPDH (Hs99999905_m1) was performed using the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) in accordance with manufacturer's instruction using StepOnePlus real-time PCR system (Applied Biosystems). .. The human 5′ SLCO4C1 promoter region (−129 bp, −504 bp and −3886 bp) were amplified by PCR and inserted into the Article Title: Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT) Article Snippet: .. Generating C3 promoter-luciferase reporter gene construct One thousand two hundred and fifty six nucleotides from the C3 promoter (−1005 to +251) was amplified from human blood genomic DNA (Clontech), using Forward primer containing KpnI restriction enzyme cleavage site (5′- GGG GTA CCG AAT ATG CTG TCA ACA GGG ATG -3′) and reverse primer containing BglII restriction enzyme cleavage site (5′- GGA AGA TCT AAC CAC AAA CAC CCA AAC TCA C -3′), and cloned into the |
